PCR Anneal-Temp (℃) / Method: Td Main product (bp): 300 Comment on PCR: F-primer: GCAGAATCATACAAGCCGACC R-primer: GTGATGTGTTGGGCGAAAC
EST info
EST Accession number 1: CN189225 EST Accession number 2:
sequence-tagged site (STS seq)
Experiments: Restriction fragment profile
Compared cultivars (Left, (Middle), Right): A255(Okitsu46gou)/G434(Kankitsu Chuukanbohon Nou5) Comment: Figure legend: Rsa1 digestion of A255 is not complete. Refer to additional lane in the right for Rsa1 and Pvu2 digestion of A255.