Locus name: Al0604
CAPS PCR info
PCR Anneal-Temp (℃) / Method: 58
Main product (bp): 2800
Comment on PCR:
F-primer: GAAGGAACGATAAAGCGAACA
R-primer: TCAAAGAACAGGGCACTCAG
EST info
EST Accession number 1: C95425
EST Accession number 2: DC893008
sequence-tagged site (STS seq)
Experiments: Restriction fragment profile
Compared cultivars (Left, (Middle), Right): Trovita orange/Kiyomi/Miyagawa-wase
Comment: PCR_condition: 58C aneal
Figure legend:
Experiments: CAPS pattern of hybrid cultivar
Experiments: CAPS pattern of Citrus collection
Experiments: Segregation pattern
Target on C. clementina (v1.0)
Transcript ID: Ciclev10000084m
Scaffold: scaffold_5
Start: 33791194
End: 33800828
Target on C. unshiu (v1.0)
AGI map info (Shimada et al. 2014)
KmMg map info (Omura et al. 2003)
JtTr map info (Omura et al. 2003)
Km/O41 map info (Nakano et al. 2003)
Rp/Sa map info (Ohta et al. 2011)
CAPS genotyping (Hybrid cv/Citrus collection)
Cultivar identification (M: Cultivar identification manual / T: Ninomiya et al. 2015/ K: Nonaka et al. 2017)
SNP typing by Illumina GoldenGate assay (Fujii et al. 2013)