Citrus CAPS Marker Database

Locus name: Al0635


CAPS PCR info

PCR Anneal-Temp (℃) / Method: 56
Main product (bp): 1800
Comment on PCR:
F-primer: CTCCCAATCTCAAAGGTTTC
R-primer: ACCAGTAGTACCAGCCAAGTC

EST info

EST Accession number 1: C95530
EST Accession number 2: DC893068

sequence-tagged site (STS seq)

STS:
TGTTCTTATTTACATGCTTACATATTTGGAATGCTATTTTCTGACATGAACATGCTAAGA
TCTATGATTTTGAGTCTCAGATTCGGGGGAAAAATGTCTAATTTGTAGAAACTTTTCAAT
TTTGGAGGCTATATATTGCAGATCTGCCGATGGGTTTTCATTGGGGTTCTGTTTGGTTAC
GGGGAAAATGTGGGAAAATAGGAAGTGGTTTGAATCTGAAAGATACCGTTTTTCTAACCG
GAGTCTATTTGTTTGCCATTTTTGTTCATTTGGGATCATTGAAGTTTCCATTTTGTTGTG
GATCCAAGAAAATGGAAACTATATTGACATTTTTGGATCTCCATTTTGGCTTTCTTAAGG
AAATGCAACTTTCATGTGGGTGAAAACTGTTTCCTTTGGCTGATTTTTGTAGCTATGGTT
TTNTTAAATGCTAATGTTATGTTGGATCCGAGTTTGATAAATATTTTCTTCTTGGATTTC
ACTTCACATTTTAGAACTTTATTTGATGTCTTGGCTTTCAAGCCTCTGTTTTCTTTTGCA
TTTTATTAATATGAGGCTGACATCTTCAATGCTAGATCTGTTAAGATTGTGAGAAAATCT
AATTTCNTGCACCATATTGTTGCTGTAAATTTGTAGCTTTTCATGGATGATGATGCGTTG
AACATGCGCATTGGGGTTACTATGACCGTCCTTAAGGGCATCTCG
STS source: Clementine haploid
STS Forward / Reverse: Foward read

Experiments: Restriction fragment profile

Compared cultivars (Left, (Middle), Right): Trovita orange/Kiyomi/Miyagawa-wase
Comment:
Figure legend:

Compared cultivars (Left, (Middle), Right): A255(Okitsu46gou)/G434(Kankitsu Chuukanbohon Nou5)
Comment:
Figure legend:

Compared cultivars (Left, (Middle), Right): Frying dragon/Hyuuganatsu
Comment:
Figure legend:

Experiments: CAPS pattern of hybrid cultivar

Resriction enzyme: Msp1
Rank as CAPS marker: Available marker
Comment:
Figure legend:
CVName 1. Nagami, 2. Budha's, 3. Miyagawa, 4. Trovita, 5. Kiyomi, 6. Tachibana, 7. Koji, 8. Kinokuni (8' Hirakishu), 9. Mato pumello, 10. Kunip,
11. King, 12. Ponkan (12' Ohta ponkan), 13. Dancy, 14. Willowleaf, 15. Clementine, 16. C-haploid, 17. Encore, 18. Amaka, 19. Youkou, 20. Shiranuhi,
21. Harumi, 22. Nishinokaori, 23. Duncan GF, 24. Mineola, 25. Seminol, 26. Seihou, 27. Akemi, 28. Tsunokaori, 29. Ariake, 30. Nankou,
31. Mihocore, 32. Hareyaka, 34. Harehime, 35. Hayaka, 36. Southern Red, 37. Amakusa, 38. Setoka, *. Flying Dragon, SY(Southern Yellow), 40(MK, Mukakukishu)

Experiments: CAPS pattern of Citrus collection


Experiments: Segregation pattern

Population name: A255 (Okitsu46gou) x G434 (Kankitsu Chuukanbohon Nou5gou)
Restriction enzyme: Hinf1
Comment:
Figure legend:
A: A255 (Okitu46gou), G: G434 (Kankitsu Chuukanbohon Nou5gou),
K or Km: Kiyomi, M or Mg: Miyagawa-wase, MK: Mukaku kisyu,
LE: Lee, O: Okitsu41gou, RP or RP94: Kankitsu Chukanbohon Nou6gou,
Sacd or SA: Siamese Acidless, SW: Sweet spring, T or Tr: Trovita orange,
X: meaningless

Population name: Jutaro unshu x Trovita orange
Restriction enzyme: Msp1
Comment:
Figure legend:
A: A255 (Okitu46gou), G: G434 (Kankitsu Chuukanbohon Nou5gou),
K or Km: Kiyomi, M or Mg: Miyagawa-wase, MK: Mukaku kisyu,
LE: Lee, O: Okitsu41gou, RP or RP94: Kankitsu Chukanbohon Nou6gou,
Sacd or SA: Siamese Acidless, SW: Sweet spring, T or Tr: Trovita orange,
X: meaningless

Population name: Kiyomi x Miyagawa-wase
Restriction enzyme: Msp1
Comment:
Figure legend:
A: A255 (Okitu46gou), G: G434 (Kankitsu Chuukanbohon Nou5gou),
K or Km: Kiyomi, M or Mg: Miyagawa-wase, MK: Mukaku kisyu,
LE: Lee, O: Okitsu41gou, RP or RP94: Kankitsu Chukanbohon Nou6gou,
Sacd or SA: Siamese Acidless, SW: Sweet spring, T or Tr: Trovita orange,
X: meaningless

Population name: Kiyomi x Okitsu41gou
Restriction enzyme: Msp1
Comment:
Figure legend:
A: A255 (Okitu46gou), G: G434 (Kankitsu Chuukanbohon Nou5gou),
K or Km: Kiyomi, M or Mg: Miyagawa-wase, MK: Mukaku kisyu,
LE: Lee, O: Okitsu41gou, RP or RP94: Kankitsu Chukanbohon Nou6gou,
Sacd or SA: Siamese Acidless, SW: Sweet spring, T or Tr: Trovita orange,
X: meaningless

Target on C. clementina (v1.0)

Transcript ID: Ciclev10015354m
Scaffold: scaffold_2
Start: 26435540
End: 26438838

Target on C. unshiu (v1.0)

Transcript ID: C_unshiu_00197:mRNA_27.1
Scaffold: C_unshiu_00197
Start: 251131
End: 253300
Gene function: GAGA-binding transcriptional activator

AGI map info (Shimada et al. 2014)

AGI LG: AGI-06
AGI cM: 69.195

KmMg map info (Omura et al. 2003)

KmMg LG: KmG-06
KmMg cM: 15.268

JtTr map info (Omura et al. 2003)

JtTr LG: JtR-06S
JtTr cM: 1.903

Km/O41 map info (Nakano et al. 2003)

Km/O41 LG: NAT-06S
Km/O41 cM: 7.869

Rp/Sa map info (Ohta et al. 2011)

Rp/Sa LG:
Rp/Sa cM:

CAPS genotyping (Hybrid cv/Citrus collection)

CAPS genotyping: Hb

Cultivar identification (M: Cultivar identification manual / T: Ninomiya et al. 2015/ K: Nonaka et al. 2017)

Cultivar identification M/T/K:

SNP typing by Illumina GoldenGate assay (Fujii et al. 2013)

SNP1:
DNA sequence around SNP1:
SNP2:
DNA sequence around SNP2:
SNP3:
DNA sequence around SNP3:
SNP4:
DNA sequence around SNP4: