Citrus CAPS Marker Database

Locus name: Lp0037

CAPS PCR info

PCR Anneal-Temp (℃) / Method: 56
Main product (bp): 700
Comment on PCR:
F-primer: CGGCTGACGATGGAGATA
R-primer: CTAAAAATGGCCCTAAAATGC

EST info

EST Accession number 1: AU300385
EST Accession number 2: DC893151

sequence-tagged site (STS seq)

Experiments: Restriction fragment profile

Compared cultivars (Left, (Middle), Right): Trovita orange/Kiyomi/Miyagawa-wase
Comment:
Figure legend:
Compared cultivars (Left, (Middle), Right): A255(Okitsu46gou)/G434(Kankitsu Chuukanbohon Nou5)
Comment:
Figure legend:

Experiments: CAPS pattern of hybrid cultivar

Resriction enzyme: Msp1
Rank as CAPS marker: Others
Comment:
Figure legend:
CVName 1. Nagami, 2. Budha's, 3. Miyagawa, 4. Trovita, 5. Kiyomi, 6. Tachibana, 7. Koji, 8. Kinokuni (8' Hirakishu), 9. Mato pumello, 10. Kunip,
11. King, 12. Ponkan (12' Ohta ponkan), 13. Dancy, 14. Willowleaf, 15. Clementine, 16. C-haploid, 17. Encore, 18. Amaka, 19. Youkou, 20. Shiranuhi,
21. Harumi, 22. Nishinokaori, 23. Duncan GF, 24. Mineola, 25. Seminol, 26. Seihou, 27. Akemi, 28. Tsunokaori, 29. Ariake, 30. Nankou,
31. Mihocore, 32. Hareyaka, 34. Harehime, 35. Hayaka, 36. Southern Red, 37. Amakusa, 38. Setoka, *. Flying Dragon, SY(Southern Yellow), 40(MK, Mukakukishu)

Experiments: CAPS pattern of Citrus collection

Experiments: Segregation pattern

Target on C. clementina (v1.0)

Transcript ID: Ciclev10025045m
Scaffold: scaffold_7
Start: 18963487
End: 18968140

Target on C. unshiu (v1.0)

AGI map info (Shimada et al. 2014)

KmMg map info (Omura et al. 2003)

JtTr map info (Omura et al. 2003)

Km/O41 map info (Nakano et al. 2003)

Rp/Sa map info (Ohta et al. 2011)

CAPS genotyping (Hybrid cv/Citrus collection)

Cultivar identification (M: Cultivar identification manual / T: Ninomiya et al. 2015/ K: Nonaka et al. 2017)

SNP typing by Illumina GoldenGate assay (Fujii et al. 2013)