Citrus CAPS Marker Database

Locus name: Su0003


CAPS PCR info

PCR Anneal-Temp (℃) / Method: Td
Main product (bp): 600
Comment on PCR:
F-primer: GGATGGAAGAAGGGTACAAGG
R-primer: TACAGAGAAAAAGCAACGCA

EST info

EST Accession number 1: DC895525
EST Accession number 2:

sequence-tagged site (STS seq)


Experiments: Restriction fragment profile

Compared cultivars (Left, (Middle), Right): A255(Okitsu46gou)/G434(Kankitsu Chuukanbohon Nou5)
Comment:
Figure legend:

Experiments: CAPS pattern of hybrid cultivar


Experiments: CAPS pattern of Citrus collection


Experiments: Segregation pattern

Population name: A255 (Okitsu46gou) x G434 (Kankitsu Chuukanbohon Nou5gou)
Restriction enzyme: Sty1
Comment:
Figure legend:
A: A255 (Okitu46gou), G: G434 (Kankitsu Chuukanbohon Nou5gou),
K or Km: Kiyomi, M or Mg: Miyagawa-wase, MK: Mukaku kisyu,
LE: Lee, O: Okitsu41gou, RP or RP94: Kankitsu Chukanbohon Nou6gou,
Sacd or SA: Siamese Acidless, SW: Sweet spring, T or Tr: Trovita orange,
X: meaningless

Target on C. clementina (v1.0)

Transcript ID: Ciclev10016063m
Scaffold: scaffold_2
Start: 10456899
End: 10459385

Target on C. unshiu (v1.0)

AGI map info (Shimada et al. 2014)

KmMg map info (Omura et al. 2003)

JtTr map info (Omura et al. 2003)

Km/O41 map info (Nakano et al. 2003)

Rp/Sa map info (Ohta et al. 2011)

CAPS genotyping (Hybrid cv/Citrus collection)

Cultivar identification (M: Cultivar identification manual / T: Ninomiya et al. 2015/ K: Nonaka et al. 2017)

SNP typing by Illumina GoldenGate assay (Fujii et al. 2013)