Citrus CAPS Marker Database

Locus name: Tf0104


CAPS PCR info

PCR Anneal-Temp (℃) / Method: Td
Main product (bp): 1200
Comment on PCR:
F-primer: CGCTTCTCACTTCCTACTTCC
R-primer: TATGCTCTTCTTCCGTCCATC

EST info

EST Accession number 1: CD575870
EST Accession number 2:

sequence-tagged site (STS seq)


Experiments: Restriction fragment profile

Compared cultivars (Left, (Middle), Right): A255(Okitsu46gou)/G434(Kankitsu Chuukanbohon Nou5)
Comment:
Figure legend:

Experiments: CAPS pattern of hybrid cultivar


Experiments: CAPS pattern of Citrus collection


Experiments: Segregation pattern


Target on C. clementina (v1.0)

Transcript ID: Ciclev10011554m
Scaffold: scaffold_6
Start: 21450811
End: 21454133

Target on C. unshiu (v1.0)

AGI map info (Shimada et al. 2014)

KmMg map info (Omura et al. 2003)

JtTr map info (Omura et al. 2003)

Km/O41 map info (Nakano et al. 2003)

Rp/Sa map info (Ohta et al. 2011)

CAPS genotyping (Hybrid cv/Citrus collection)

Cultivar identification (M: Cultivar identification manual / T: Ninomiya et al. 2015/ K: Nonaka et al. 2017)

SNP typing by Illumina GoldenGate assay (Fujii et al. 2013)