Citrus CAPS Marker Database

Locus name: Tf0331


CAPS PCR info

PCR Anneal-Temp (℃) / Method: 64
Main product (bp): 1900
Comment on PCR:
F-primer: GATTGGGATGCTGTTATTGAT
R-primer: TGCCATTGCTTGTCGTAAA

EST info

EST Accession number 1: CK939347
EST Accession number 2:

sequence-tagged site (STS seq)

STS:
CTGTGATTTTTGACACTTCAATTGTACCTTGGTGGGCATGGATAAAGAGATTCCATCTAC
CTGAAGCTGAATTGCTTAATGGTGTGACAGATCCCTCTTTTTCATTTTCAGTGTATTTAT
ATGATGCATCTCTGCTGTGATGCTAGTCCGACTGATGTTATTTTATGAACTTGTCACAGG
CCGTGCTGCAATGATTGGATTCTTCATGGCTTATCTGGTTGATAGCTTGACTGGAGTAGG
TCTGGTGGACCAAATGAGCAACTTCTTCTGC
STS source:
STS Forward / Reverse:

Experiments: Restriction fragment profile


Experiments: CAPS pattern of hybrid cultivar


Experiments: CAPS pattern of Citrus collection


Experiments: Segregation pattern

Population name: A255 (Okitsu46gou) x G434 (Kankitsu Chuukanbohon Nou5gou)
Restriction enzyme: NC
Comment:
Figure legend:
A: A255 (Okitu46gou), G: G434 (Kankitsu Chuukanbohon Nou5gou),
K or Km: Kiyomi, M or Mg: Miyagawa-wase, MK: Mukaku kisyu,
LE: Lee, O: Okitsu41gou, RP or RP94: Kankitsu Chukanbohon Nou6gou,
Sacd or SA: Siamese Acidless, SW: Sweet spring, T or Tr: Trovita orange,
X: meaningless

Target on C. clementina (v1.0)

Transcript ID: Ciclev10021868m
Scaffold: scaffold_3
Start: 4831751
End: 4834270

Target on C. unshiu (v1.0)

AGI map info (Shimada et al. 2014)

KmMg map info (Omura et al. 2003)

JtTr map info (Omura et al. 2003)

Km/O41 map info (Nakano et al. 2003)

Rp/Sa map info (Ohta et al. 2011)

CAPS genotyping (Hybrid cv/Citrus collection)

Cultivar identification (M: Cultivar identification manual / T: Ninomiya et al. 2015/ K: Nonaka et al. 2017)

SNP typing by Illumina GoldenGate assay (Fujii et al. 2013)