Citrus CAPS Marker Database

Locus name (alias): Wy0050 (Wy0050.k)


CAPS PCR info

PCR Anneal-Temp (℃) / Method: 54
Main product (bp):
Comment on PCR: PCR unstable
F-primer: TGTACGCTTCCCGCTCTCT
R-primer: ACGTGCCATGAAAAACAAAAA

EST info

EST Accession number 1: DC894369
EST Accession number 2: DC894370

sequence-tagged site (STS seq)


Experiments: Restriction fragment profile


Experiments: CAPS pattern of hybrid cultivar


Experiments: CAPS pattern of Citrus collection


Experiments: Segregation pattern


Target on C. clementina (v1.0)

Transcript ID: Ciclev10005669m
Scaffold: scaffold_9
Start: 28556663
End: 28560571

Target on C. unshiu (v1.0)

AGI map info (Shimada et al. 2014)

KmMg map info (Omura et al. 2003)

JtTr map info (Omura et al. 2003)

Km/O41 map info (Nakano et al. 2003)

Rp/Sa map info (Ohta et al. 2011)

CAPS genotyping (Hybrid cv/Citrus collection)

Cultivar identification (M: Cultivar identification manual / T: Ninomiya et al. 2015/ K: Nonaka et al. 2017)

SNP typing by Illumina GoldenGate assay (Fujii et al. 2013)